Les gènes sont des plans de construction de protéines

Le plan de construction d’une protéine se trouve précisément dans les gènes. (Image: CanStockPhoto)

Au cours du dernier chapitre, nous avons appris que l'ADN est composé de quatre éléments qui sont désignés par les lettres A, C, G et T.

On pourrait donc dire que dans le noyau de chacune des cellules de ton corps se cache un livre, écrit avec les lettres A, C, G, et T. Un gène correspondrait alors à une certaine phrase de ce livre. Le nombre exact de gènes que possède un être humain n'est toujours pas connu. Les experts estiment leur nombre entre 20'000 et 25'000. Ensemble, ils représentent seulement deux pour cent de notre patrimoine héréditaire. Tous les gènes ne comportent pas le même nombre de lettres. Un gène court compte environ 500 lettres alors qu'un gène long en compte plusieurs centaines de milliers.

Dans toutes tes cellules se trouve le même livre avec la même succession de lettres. Une cellule particulière ne lit que les phrases (gènes) contenant les informations qui lui sont nécessaires sur le moment pour pouvoir remplir sa fonction dans le corps. Une cellule sanguine ne lit donc pas exactement les mêmes phrases (gènes) qu'une cellule musculaire.

Une copie du gène est faite dans le noyau cellulaire

Avant qu'une cellule ne puisse lire un gène, une copie en est faite dans le noyau cellulaire. Les deux brins du filament génétique se séparent à l'endroit où se trouve le gène, de sorte que les lettres A, C, G et T soient libérées. Le duplicateur (nommé ARN polymérase) situé dans le noyau utilise alors un des brins en guise d'original et le copie lettre par lettre. Ce processus résulte en la copie du gène. Si on reprend la comparaison avec un livre, on peut dire qu'une copie d'une phrase dans le livre du noyau de la cellule a été faite.

Il y a une différence entre le gène d'origine et sa copie: en remplacement de la Thymine (T), on trouve l'Uracile (U). L'original du gène se compose donc de A, C, G et T, alors que sa copie se compose de A, C, G et U. On ne parle plus d'ADN pour la copie, comme on le fait pour l'original, mais d'acide ribonucléique ou ARN.

De la copie du gène résulte une chaîne d'acides aminés

La copie du gène est exportée hors du noyau cellulaire. Elle est alors lue par la fabrique de protéines de la cellule, il s'agit des ribosomes. Les ribosomes lisent la phrase (la copie du gène) du début jusqu'à la fin. Ceci en lisant par groupes de trois lettres. Si une phrase se compose, par exemple, de AUGGUGCACCUGACUCCUGAGGAGAAG, les ribosomes liront AUG, GUG, CAC, CUG, ACU, CCU, GAG, GAG, AAG.

Dans la copie d'un gène, il est écrit comment une protéine particulière doit être fabriquée. Les protéines se composent d'éléments de base appelés acides aminés. Il existe 20 acides aminés différents. Un groupe donné de trois lettres représente un acide aminé particulier. GUC, par exemple, correspond à l'acide aminé «valine» et CAC à l'acide aminé «histidine». Le décodeur permettant à la cellule de traduire les mots de 3 lettres en acides aminés se nomme le code génétique. Quand les ribosomes lisent une phrase (copie du gène) par groupes de trois lettres, ils savent exactement lequel des vingt acides aminés doit être associé à un mot de trois lettres donné et dans quel ordre. Les ribosomes assemblent les acides aminés les uns après les autres afin d'obtenir finalement la protéine complète. 

Une seule erreur d'écriture présente dans une copie du gène peut conduire à la fabrication d'une protéine défectueuse. A l'endroit où se trouve une faute d'orthographe, les ribosomes insèrent un acide aminé erroné. Cette faute peut avoir des conséquences graves. Ceci est démontré par l'exemple de la maladie nommée anémie falciforme. Dans ce cas, en raison d'une protéine défectueuse, les cellules sanguines ont une forme différente de la normale et fonctionnent moins bien que celles de personnes en bonne santé.

Ce sujet en vidéo

Ce contenu provient du site internet gene-abc.ch, une initiative du Fonds national suisse de la recherche scientifique (FNS). Ce site internet a été fermé. La gestion et la mise à jour de ses contenus a été confiée en 2016 à la Fondation SimplyScience, qui les a intégrés à sa plateforme SimplyScience.ch.